Skip to main content

Advertisement

Table 1 PCR Primer Sequences

From: Downregulation of connective tissue growth factor inhibits the growth and invasion of gastric cancer cells and attenuates peritoneal dissemination

Gene Primer Sequences (5'-3') Forward and Reverse Product (bp)
CTGF CTTGCGAAGCTGACCTGGAA AAAGCTCAAACTTGATAGGCTTGGA 90
MMP-2 ATGACATCAAGGGCATTCAGGAG TCTGAGCGATGCCATCAAATACA 135
MMP-3 GGGTGAGGACACCAGCATGA CAGAGTGTCGGAGTCCAGCTTC 178
MMP-9 TCCCAGACCTGGGCAGATTC GCAAAGGCGTCGTCAATCAC 124
Cyclin D1 GATGCCAACCTCCTCAACGAC CTCCTCGCACTTCTGTTCCTC 171
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA 138