Skip to main content

Table 1 PCR Primer Sequences

From: Downregulation of connective tissue growth factor inhibits the growth and invasion of gastric cancer cells and attenuates peritoneal dissemination

Gene Primer Sequences (5'-3') Forward and Reverse Product (bp)
CTGF CTTGCGAAGCTGACCTGGAA
AAAGCTCAAACTTGATAGGCTTGGA
90
MMP-2 ATGACATCAAGGGCATTCAGGAG
TCTGAGCGATGCCATCAAATACA
135
MMP-3 GGGTGAGGACACCAGCATGA
CAGAGTGTCGGAGTCCAGCTTC
178
MMP-9 TCCCAGACCTGGGCAGATTC
GCAAAGGCGTCGTCAATCAC
124
Cyclin D1 GATGCCAACCTCCTCAACGAC
CTCCTCGCACTTCTGTTCCTC
171
GAPDH GCACCGTCAAGGCTGAGAAC
TGGTGAAGACGCCAGTGGA
138