Skip to main content

Table 4 Primer sequences used for assessment of mRNA levels by qRT-PCR

From: Silencing of a large microRNA cluster on human chromosome 14q32 in melanoma: biological effects of mir-376a and mir-376c on insulin growth factor 1 receptor

Gene name Forward Reverse
β-actin CCTGGCACCCAGCACAAT GCCGATCCACACGGAGTACT
Meg3 TGCGGAAGAGGCCCTGAT GTCCAGAGTCTCTGGGTCCA
Meg8 CAGTGTTGCCTGGGTCTGA ATCCCCTTGAAAGAGCAGGA
Rtl1 CCTGCCCTGCGTCAGAACCG TGCTGGAGACAGGGAGGCGT
Dio3 TGGTGGTCGGAGAGGGCGAG CGGTTGTCGTCGGACACGCA