Skip to main content

Table 2 List of primers for qRT-PCR

From: Regulation of colony stimulating factor-1 expression and ovarian cancer cell behavior in vitro by miR-128 and miR-152

miRNA-R GTGCAGGGTCCGAGGT
miR-128-F TCCGATCACAGTGAACCGGT
miR-128-RT GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC AAAGAG
miR-152-F TCCGA TCAGTGCATGACAGA
miR-152-RT GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC CCAAGT
miR-27a-F TCCGA TTCACAGTGGCTAA
miR-27a-RT GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC GCGGAAC
miR-214-F TCCGA ACAGCAGGCACAGAC
miR-214-RT GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC ACTGCCT
miR-454-F TCCGA TAGTGCAATATTGCTTA
miR-454-RT GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC ACCCTA
CSF-1-F CATCTCAGCCCCACCTGCATGGTA
CSF-1-R TCCTGGGCAGGAAGGGAAAGTC
GAPDH-F GCAGGCGTCGGAGGGCCCCCTC
GAPDH-R GGGACTGAGTGTGGCAGGGACTCC
G-418-F TCAGGATGATCTGGACGAAGAGC
G-418-R CAGCAATATCACGGGTAGCCAAC
LucE-F AACAATCCGGAAGCGACCAACG
LucE-R AACACAACTCCTCCGCGCAAC