Skip to main content

Advertisement

Table 3 qPCR primers

From: Regulation of PMP22 mRNA by G3BP1 affects cell proliferation in breast cancer cells

Primers for qPCR Sequence 5′ to 3′
SDHA forward TGGGAACAAGAGGGCATCTG
SDHA reverse CCACCACTGCATCAAATTCATG
YWHAZ forward ACTTTTGGTACATTGTGGCTTCAA
YWHAZ reverse CCGCCAGGACAAACCAGTAT
UBC forward ATTTGGGTCGCGGTTCTTG
UBC reverse TGCCTTGACATTCTCGATGGT
PMP22 forward ACATAGGGAAGGGAGGAAGG
PMP22 reverse TTGGTTTGGTTTGAGTTTGG