Skip to main content

Advertisement

Table 1 Showing the primer sequences used to amplify the genes for GM-CSF, GFP, Rae-1, and IL-21

From: Activation of cellular immunity and marked inhibition of liver cancer in a mouse model following gene therapy and tumor expression of GM-SCF, IL-21, and Rae-1

Genes Primers
GM-CSF-XhoI-F CAGATCTCGAG GCCACCATGTGGCTGCAGAATTTACTTTTC
GM-CSF-EcoRI-R GTCAGAATTC CCATTTTTGGCCTGGTTTTTTG
GFP-EcoRI-F GTCAGAATTC ATGGTGAGCAAGGGCGAG
GFP-MluI-R ACTTAACGCGT TTACTTGTACAGCTCGTCCATGC
Rae-1-Xba1-F GTACATTCTAGA GCCACCATGAGTCTGTTTGGATCAACCTCT
Rae-1-Sal1-R GAATGTCGAC GTATTTCTTATTCCTTGGCTTTAGCT
IL-21-Sal1-F GTCAGTCGAC GCCACCATGGAGAGGACCCTTGTCTGTC
IL-21-Not1-R AATTGCGGCCGC CTAGGAGAGATGCTGATGAATCATC
  1. Note: Italics indicates the enzyme cleavage sites for XhoI and EcoRI, EcoRI and MluI, Xba1and Sal1, and Sal1and Not1.