Skip to main content

Table 1 Primer sequence of BRAF and KRAS gene

From: A very low incidence of BRAF mutations in Middle Eastern colorectal carcinoma

Exon Forward primer Reverse primer
BRAF   
Exon 15 TGCTTGCTCTGATAGGAAAATG AGCATCTCAGGGCCAAAAAT
KRAS   
Exon 1 TTAACCTTATGTGTGACATGTTCTAA AGAATGGTCCTGCACCAGTAA
Exon 2 CCAGACTGTGTTTCTCCCTTC TTTAAACCCACCTATAATGGTGAA