Skip to main content

Table 1 Primer sequence for qRT-PCR

From: Induction of integrin α2 in a highly bone metastatic human prostate cancer cell line: roles of RANKL and AR under three-dimensional suspension culture

AR Forward: GACCAGATGGCTGTCATTCA
Reverse: GGAGCCATCCAAACTCTTGA
AP-4 Forward: GGAGTATTTCATGGTGCCCACT
Reverse: GTGGAATGTTGGCAAGGCTAC
E-Cad Forward: CCACCAAAGTCACGCTGAATA
Reverse: GGAGTTGGGAAATGTGAGCAA
GAPDH Forward: AGCCACATCGCTCAGACA
Reverse: GCCCAATACGACCAAATCC
ITGA2 Forward: TGGGGTGCAAACAGACAAGG
Reverse: GTAGGTCTGCTGGTTCAG
Vimentin Forward: GGAAGAGAACTTTGCCGTTGAA
  Reverse: GTGACGAGCCATTTCCTCCTT