Skip to main content

Table 1 Primers used for qRT-PCR

From: Cathepsin S-mediated autophagic flux in tumor-associated macrophages accelerate tumor development by promoting M2 polarization

Primer Forward Reverse
Human cathepsin B 5′gtttgcattgctggtcagga3′ 5′tggcaggacagtggaatgat3′
Human cathepsin D 5′gcgagtacatgatcccctgt3′ 5′ctctggggacagcttgtagc3′
Human cathepsin F 5′ tggcaacaagatgaagcaag3′ 5′ttttgtgacagcccccttac3′
Human cathepsin H 5′actggctgttgggtatggag3′ 5′ aggccacacatgttctttcc3′
Human cathepsin K 5′ccgcagtaatgacacccttt3′ 5′gcacccacagagctaaaagc3′
Human cathepsin L 5′acagtggaccaagtggaagg3′ 5′cttctcccacactgctctcc3′
Human cathepsin S 5′tcatacgatctgggcatgaa3′ 5′aggttctgggcactgagaga3′
Human cathepsin Z 5′aagggggtaatgacctgtcc3′ 5′ttcattgcatgtcccacatt3′
Human GAPDH 5′acagtcagccgcatcttctt3′ 5′acgaccaaatccgttgactc3′
Mouse Arg-1 5′aaagctggtctgctggaaaa3′ 5′ acagaccgtgggttcttcac3′
Mouse FIZZ1 5′ttgcaactgcctgtgcttac3′ 5′ctgggttctccacctcttca3′
Mouse IL-10 5′ccaagccttatcggaaatga3′ 5′ttttcacaggggagaaatcg3′
Mouse iNOS 5′gggctgtcacggagatca3′ 5′ccatgatggtcacattctgc3′
Mouse IL-1β 5′gcccatcctctgtgactcat3′ 5′aggccacaggtattttgtcg3′
Mouse TNF-α 5′tcttctcattcctgcttgtgg3′ 5′ggtctgggccatagaactga3′
Mouse Tubulin 5′tctaacccgttgctatcatgc3′ 5′gccatgttccaggcagtag3′
  1. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Arg-1, arginase-1; FIZZ1, found in inflammatory zone 1; IL-10, interleukin 10; iNOS, inducible NO synthase; IL-1β, interleukin 1β; TNF-α, tumor necrosis factor-alpha.