Skip to main content

Table 1 Primers used for real-time RT-PCR

From: Chemoprevention of dietary digitoflavone on colitis-associated colon tumorigenesis through inducing Nrf2 signaling pathway and inhibition of inflammation

Primer Sequences
hNrf2 Forward primer,5′- CATCCAGTCAGAAACCAGTGG
Reverse primer ,5′- GCAGTCATCAAAGTACAAAGCAT
hKeap1 Forward primer, 5′-CCTTCAGCTACACCCTGGAG
Reverse primer, 5′-CATGACCTTGGGGTGGATAC
hGR Forward primer, 5′-CACGGA GGAGCTGGAGAAC
Reverse primer, 5′- CGACAAAGTCTTTTTAACCTCCTT
hTR Forward primer, 5′-CAGACG GGGAGGCTTTTC
Reverse primer, 5′- CCGAGAGCGTTCCTTTCA
hHO-1 Forward primer, 5′- TCCTGGCTCAGCCTCAAATG;
Reverse primer, 5′- CGTTAAACACCTCCCTCCCC
hr-GCSc Forward primer, 5′-CTGTTGCAGGAAGGCATTGAT
Reverse primer, 5′- TTCAAACAGTGTCAGTGGGTCTCT
hr-GCSm Forward primer, 5′- GGCACAGGTAAAACCAAATAGTAAC
Reverse primer, 5′- CAAATTGTTTAGCAAATGCAGTCA
hNQO1 Forward primer, 5′- GGGATCCACGGGGACATGAATG
Reverse primer, 5′- ATTTGAATTCGGGCGTCTGCTG
hUGT1A1 Forward primer, 5′-TAAGTGGCTACCCCAAAACG
Reverse primer, 5′- TCCAGCTCCCTTAGTCTCCA
hUGT1A10 Forward primer, 5′- CGTGTTCTGGGTGGAGTTTG
Reverse primer, 5′- TTTTCCCCAAGCATTTCCGG
hGAPDH Forward primer, 5′- TGCACCACCAACTGCTTAGC
Reverse primer, 5′- GGCATGGACTGTGGTCATGAG
mGR Forward primer, 5′- AGTGCACTCGGAATTCATGC
Reverse primer, 5′- CAATCAGGATGTGTGGAGCG
mTR Forward primer, 5′- ATCCACAAACAGCGAGGAGA
Reverse primer, 5′- TTGGTCTGCTCTTCATCCGT
mHO-1 Forward primer, 5′- GCCACCAAGGAGGTACACAT
Reverse primer, 5′- GCTTGTTGCGCTCTATCTCC
mr-GCSc Forward primer, 5′- GGCCACTATCTGCCCAATTG
Reverse primer, 5′- TGTTCTTCAGAGGCTCCAGG
mr-GCSm Forward primer, 5′- GGAGGGGCTCTTAACTCCAG
Reverse primer, 5′- CTCAACACAGTGCCGAACAA
mNQO1 Forward primer, 5′- ACAGGTGAGCTGAAGGACTC
Reverse primer, 5′- GTTGTCGTACATGGCAGCAT
mUGT1A1 Forward primer, 5′- GGAGGCTGTTAGTGTTCCCT
Reverse primer, 5′- CCGTCCAAGTTCCACCAAAG
mUGT1A10 Forward primer, 5′- GACTCGGGCATTCATCACAC
Reverse primer, 5′- GCGCATGATGTTCTCCTTGT
mTNF-a Forward primer, 5′- GACCCCTTTACTCTGACCCC
Reverse primer, 5′- AGGCTCCAGTGAATTCGGAA
mIL-1b Forward primer, 5′- ACTCATTGTGGCTGTGGAGA
Reverse primer, 5′- TTGTTCATCTCGGAGCCTGT
mIL-6 Forward primer, 5′- CTGCAAGAGACTTCCATCCAGTT
Reverse primer, 5′- GAAGTAGGGAAGGCCGTGG
mGAPDH Forward primer, 5′- CTCCCACTCTTCCACCTTCG
  Reverse primer, 5′- CCACCACCCTGTTGCTGTAG