Skip to main content

Table 5 Primers used in this study

From: Tag SNPs in complement receptor-1 contribute to the susceptibility to non-small cell lung cancer

SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences
rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT
rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG
rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC
rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG
rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC
rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC
rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA
rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC
rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT
rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT
rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA
rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA
rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT ACGTTGGATGCCCAGTCTATGGAGTTTCTG AGACTGAGACAGTTGGT