Skip to main content

Table II Oligonucleotides used for generating PCR-probes. Genbank accession and their corresponding EST sequence numbers are given in parentheses. F and R denote forward and reverse primers.

From: Analysis of VEGF-responsive Genes Involved in the activation of endothelial cells

Genes (accession number)   Primers
α2 integrin (X17033 /NM_002203) (F) 5'-CTGTAGTAATGTTACCTGCTGGTT-3'
  (R) 5'-GGTCTCATCAATCTCATCTGGATT-3'
KDR/VEGFR-2 (X61656) (F) 5'-GGTTCTGAGTCCGTCTCATGGAATTG-3'
  (R) 5'-GTGTAATTTCCTGTGTCTCTTTCACTC-3'
VE-cadherin(X79981) (F) 5'-GATGTTCCCGGAGATCAGAAGACGTC-3'
  (R) 5'-TGACTGATGCC ACTTCTCCAAGGTGTG-3'
MMP1 (X54925/NM_002421) (F) 5'-CTCTAGAGTCACTGATAC AC AG-3'
  (R) 5'-CAGGGTGAC ACCAGTGACTGCAC-3'
MMP2 (NM_004530) (F) 5'-GC AGCCGTGCCTTCAGCTCTAC AG-3'
  (R) 5'-GAAAGGAGAAGAGCCTGAAGTGT-3'
Clone 3B (U25997) (F) 5'-GGAC ACTGCCTTAGCCTCTTGGA-3'
  (R) 5'-ATGC AAACTGGTCTAGGTCAGCC-3'
Clone 7D (X65873) (F) 5'-GGCATTCTGCACAGATTGCTAAAC-3'
  (R) 5'-CCTAAGATGCC AAAATTGCACTC-3'
Clone 12F (BE468199/EST hz69e06.xl/) (F) 5'-GGACCAGAGCAGAAGGCCGAGCG-3'
  (R) 5'-GGAAGGCCTCGTTAATATCCCGC-3'
Clone 22G (AA130020/EST zo40c12.rl) (F) 5'-GCTTCAGATTTACCAACAGCATG-3'
  (R) 5'-GGAAGC ATTTCTGTGATTGGTTT-3'
Clone 33A (T35116/AF480883/EST80550) (F) 5'GGAGGATCCCTCGCGCCGCAGCCAGCGCCA-3'
  (R) 5'-GTGGCACCTAC ATCATGTTGTGGTG-3'
Clone37F (XM_029746) (F) 5'-GGTTGATTAAATA ATCTTGACAATG-3'
  (R) 5'-CCTTGAACTTC AACAACGTTAAAC-3'
Clone 48A (NM_014776) (F) 5'-GGCAGAGGTGCACTTTATGAAACT-3'
  (R) 5'-ACGTTACCTTCAACCAGGACAAGG-3'
Clone 54C (AI401257/ESTtg86g04.xl) (F) 5'-GC AGTGTTTGTTTTCC AGTCTAG-3'
  (R) 5'-GGCTATGGATCTTGATAAAGTAT-3'
Clone 77D (AF169312) (F) 5'-AGGACACGGCCTATAGCCTGCAG-3'
  (R) 5'-AGAGGCGGCTCTTGGCGCAGTT-3'
Clone 94H (BC013016) (F) 5'-GGTC ACATGGATGAGGAGAATGA-3'
  (R) 5'-TTGGATAAAGTCTTGATGATCTCC-3'
Clone 263F (BC028674) (F) 5'-GTATTGGATTGCCACACGGCTC A-3'
  (R) 5'-CGATGCATTGTTATCATTAACCAG-3'
Clone 309 C (NM_015 136) (F) 5'-GCTTTGTGGAC AACATGACGCTGA-3'
  (R) 3'-CC AAGCCAAGC AGTGCTCC AGCGGC-3'
GAPDH(M33197) (F) 5'-GGTCTCCTCTGACTTC AACAGCG-3'
  (R) 5'-GGTACTTTATTGATGGTACATGAC-3'