Skip to main content

Table 2 RT-PCR primers and conditions

From: Amplification and overexpression of the ID4 gene at 6p22.3 in bladder cancer

Designation Sequence Tm(°C) Product size (bp)
GAPDH 350s TCCCATCACCATCTTCCA 62.3 379
GAPDH 350as CATCACGCCACAGTTTCC 61.9  
Aktin661S TGACGGGGTCAC 72.2 661
Aktin661AS CTAGAAGCATTT 70.9  
ID4 fw CCGCCCAACAAGAAAGTCAG 59.4 188
ID4 rv GGTGTTGAGCGCAGTGAG 58.2  
E2F3 fw ACGTCTCTTGGTCTGCTCAC 59.4 155
E2F3 rv TCTTAATGAGGTGGATGCCT 55.3  
DEK fw GTGGGTCAGTTCAGTGGC 58.2 291
DEK rv AGGACATTTGGTTCGCTTAG 55.3