Skip to main content

Table 2 RT-PCR primers and conditions

From: Amplification and overexpression of the ID4 gene at 6p22.3 in bladder cancer

Designation

Sequence

Tm(°C)

Product size (bp)

GAPDH 350s

TCCCATCACCATCTTCCA

62.3

379

GAPDH 350as

CATCACGCCACAGTTTCC

61.9

 

Aktin661S

TGACGGGGTCAC

72.2

661

Aktin661AS

CTAGAAGCATTT

70.9

 

ID4 fw

CCGCCCAACAAGAAAGTCAG

59.4

188

ID4 rv

GGTGTTGAGCGCAGTGAG

58.2

 

E2F3 fw

ACGTCTCTTGGTCTGCTCAC

59.4

155

E2F3 rv

TCTTAATGAGGTGGATGCCT

55.3

 

DEK fw

GTGGGTCAGTTCAGTGGC

58.2

291

DEK rv

AGGACATTTGGTTCGCTTAG

55.3