Skip to main content

Advertisement

Table 2 Primer sequences and PCR conditions for the amplification of PTTG1, bFGF, VEGF, IL-8, m-PTTG1 and GAPDH.

From: Ectopic expression of PTTG1/securin promotes tumorigenesis in human embryonic kidney cells

  Sense Primer Antisense Primer PCR Conditions
PTTG ATGGCTACTCTGATCTAT AAAATCTATGTCACAGCAAAC 95°C 5 min, 95°C 30 s, 54°C 30 s, 72°C 30 s. 28 cycles.
bFGF TTCTTCCTGCGCATCCACCC CTCTTAGCAGACATTGGAAG 95°C 5 min, 95°C 30 s, 56°C 30 s, 72°C 30 s. 26 cycles.
VEGF GAATCATCACGAAGTGGTGA AACGCGAGTCTGTGTTTTTG 95°C 5 min, 95°C 30 s, 56°C 30 s, 72°C 30 s. 28 cycles.
IL-8 ACCACCGGAAGGAACCATCT GAATTCTCAGCCCTCTTCAA 95°C 5 min, 95°C 30 s, 58°C 30 s, 72°C 30 s. 28 cycles.
GAPDH TGATGACATCAAGAAGGTGGT TCCTTGGAGGCCATGTGGGCC 95°C 5 min, 95°C 30 s, 54°C 30 s, 72°C 30 s. 26 cycles.
mPTTG GATGCTCTCCGCACTCTGGGAATCCAATCTG TTCACAAGTTGAGGGGCGCCCAGCTGAAACAG 95°C 5 min, 95°C 30 s, 54°C 30 s, 72°C 30 s. 35 cycles.