Skip to main content

Advertisement

Table 1 Primer sets used for amplifying and sequencing the coding regions of DFFB.

From: Attenuated Expression of DFFB is a Hallmark of Oligodendrogliomas with 1p-Allelic Loss

Name F primer seq R primer seq
DFFBamp1 gcttgcagagctcaccaggtgc cggctgaggcgaacgaaaactacc
DFFBseq1 acggatctgagcagctgg ctcctattctccccacacgc
DFFBamp2 aagcacagctcattccggtcg tgatgggcacctggagctaagc
DFFBseq2 gccctcgtcttgagacc aggacctcggagagtgc
DFFBamp3 gggggaagatgtggtcagaggctc ccacctgagtccttgctgggtacc
DFFBseq3 cttgtgaccggggcag atccaacttcttctggcacc
DFFBamp4 gctgtagtaagctgtgttcgtgccactg gcgctagcttccctcaccagagc
DFFBseq4 ggaggacagagcaagacc ccagatccacgcaagc
DFFBamp5 gggtctcagagggccatggag cctgtgtgcactgcagcttgagag
DFFBseq5 atggatcgagagccagtg ggcaagggctgaaggtc
DFFBamp6 cgggaggcggaggttgtagtaagc ctgggctgtaacacgggtgcag
DFFBseq6 gccactgcactccagc ccatggcagggacagg
DFFBamp7 gggaatttgtgaagagctgtgactgc ccccaacaattcagaaatgtaatgaaatcag
DFFBseq7 gctatgacctgttgcctgtg ggcacctgttaaaatgatgc