Skip to main content

Table 10

From: Global gene expression in neuroendocrine tumors from patients with the MEN1 syndrome

Gene Forward Primer Reverse Primer
CBLB cacgtctaaatctatagcagccagaac tgcactcccaagcctcttctc
FGF9 cggcaccagaaattcacaca aaattgtctttgtcaactttggcttag
HRK agctggttcccgttttcca cagtcccattctgtgtttctacgat
IAPP ctgctttgtatccatgagggttt gaggtttgctgaaagccacttaa
ER3 ccagcatctcaactccgtctgt caccctaaaggcgacttcaaga
SST cccagactccgtcagtttctg tacttggccagttcctgcttc
PHLDA2 tgcccattgcaaataaatcact ctgcccgcccattcct
PTK2B gtgaggagtgcaagaggcagat gccagattggccagaacct
REG1A cctcaagcacaggattccaga acatgtattttccagctgcctcta
REG1B gggtccctggtctcctacaagt catttcttgaatcctgagcatgaa
XPC gcccgcaagctggacat atcagtcacgggatgggagta