Skip to main content

Table 4 Primer sets used for RT-PCR analysis.

From: Proteomic alteration in gastic adenocarcinomas from Japanese patients

Primers   Primer sequences
MnSOD sense 5' - acgcggcctacgtgaacaacctgaa - 3'
  antisense 5' - aaccccaacctgagccttggacacc - 3'
HMG-1 sense 5' - cgggaggagcataagaagaagcacc - 3'
  antisense 5' - caatggacaggccaggatgttctcc - 3'
GAPDH sense 5' - gtcatccatgacaactttgg - 3'
  antisense 5' - tgctgtagccaaattcgttg - 3'
  1. MnSOD, manganese superoxide dismutase.
  2. HMG-1, nonhistone chromosomal protein.
  3. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.