Skip to main content

Table 5 PIG-U, PIG-T and GAA1 primer and probe sequences

From: Alterations of GPI transamidase subunits in head and neck squamous carcinoma

Gene Forward Primer Probe Reverse Primer
PIG-U AGCCCTCCAGCCAGAGTTA CAGGCGAGTGCTTGGGCAGAAGA ACTTGTGACCCTGGACTCGAA
PIG-T GATCTGCCTCACGTGCACTGT TGGCCGTGTGCTATGGCTCCTTC AGGTTCGGGTGAGGAGATTGT
Gaa1 CCGGGCTGGGACAGAGA TCCCCAAGGACCCCATTCTGCC CAGACACTCATTTATTTCCCCA