Skip to main content

Table 6 List of primer. Primer sets for qRT-PCR and sqRT-PCR

From: Gene expression profiles in primary pancreatic tumors and metastatic lesions of Ela-c-myc transgenic mice

Gene name Accession No. Quantitative or sqRT-PCR primer sequence
Upstream NM_008568.1 ACCGCGAAGTCAGTACACAA (208)
Upstream NM_013697.1 TGGAAGACACTTGGCATTTC (194)
Upstream NM_010378.2 CCTTCATCCCTTCTGACGAT (197)
Upstream NM_026490.2 TGCATCCCATGAAGAAGAGA (183)
Upstream NM_029352.3 CCTGTGCTTGAGCTCTGATT (181)
Upstream NM_009789.2 CAGCAAAATGTGTGCTGAGA (197)
Upstream NM_008817.2 ACCATTCAGGCCTCAGTTTC (205)
Upstream NM_011315.3 GCGAGCCTACTCTGACATGA (196)
Upstream NM_019815.2 GCTGTACGAGCCCTGATGAT (193)
Upstream NM_173374.3 CACTGGTGTCGTGGAGTTTG (190)
Upstream NM_013663.3 GCTTTGCTTTCGTCGAATTT (188)
Upstream NM_026030.2 GGAGTTGCTGAACCGAGTGT (180)
Upstream NM_010739.1 TGCGTGATGCTACAAAGGAC (195)
Igfbp1 (human)   
Upstream NM_000596.2 AAGGCACAGGAGACATCAGG (195)
Serpina1 (human)   
Upstream NM_001002235.1 TGCCTGATGAGGGGAAACTA (186)
  1. *PCR product size