Skip to main content

Advertisement

Table 6 List of primer. Primer sets for qRT-PCR and sqRT-PCR

From: Gene expression profiles in primary pancreatic tumors and metastatic lesions of Ela-c-myc transgenic mice

Gene name Accession No. Quantitative or sqRT-PCR primer sequence
CXCR4   
Upstream D87747 CATGGAACCGATCAGTGTGA (325)*
Downstream   TTTCCCAAAGTACCAGTCAGC
MMP2   
Upstream NM_008610 CTGTGTTCTTCGCAGGGAAT (433)
Downstream   TGTGCAGCGATGAAGATGAT
Snail2   
Upstream NM_011415 TTCCTCTGACACTTCATCCAA (474)
Downstream   TTGGAGCAGTTTTTGCACTG
E-tcad   
Upstream NM_009864 CCTGCCAATCCTGATGAAAT (329)
Downstream   TCAGGGA AGGAGCTGAAAGA
Fgf13   
Upstream AF020737 CATTTTCTGCCCAAACCACT (378)
Downstream   AATGCTTGGCACTCTTTTGC
Rsk4   
Upstream BB402211 GTGGGTGCCAAAGTTTTGAT (351)
Downstream   CAAACCACATGGAAATCAGG
MIF   
Upstream NM_010798.1 ACTACAGTAAGCTGCTGTGTGG (208)
Downstream   ATCGCTACCGGTGGATAAAC
Mcm7   
Upstream NM_008568.1 ACCGCGAAGTCAGTACACAA (208)
Downstream   GATGGTCTGCTGCTCCATAA
Ttr   
Upstream NM_013697.1 TGGAAGACACTTGGCATTTC (194)
Downstream   TGCTACTGCTTTGGCAAGAT
H2Aa   
Upstream NM_010378.2 CCTTCATCCCTTCTGACGAT (197)
Downstream   CAGGCCTTGAATGATGAAGA
Mrpl19   
Upstream NM_026490.2 TGCATCCCATGAAGAAGAGA (183)
Downstream   GACATTTGCTCGTTACAAAAGC
Dusp9   
Upstream NM_029352.3 CCTGTGCTTGAGCTCTGATT (181)
Downstream   GCTCTCCAAATTGGCTGAAT
S100g   
Upstream NM_009789.2 CAGCAAAATGTGTGCTGAGA (197)
Downstream   CTCCATCGCCATTCTTATCC
Serpina1a   
Upstream NM_009243 GCCCTGGCAAATTACATTCT (196)
Downstream   CATTGCCTGCATAATCCATC
Peg3   
Upstream NM_008817.2 ACCATTCAGGCCTCAGTTTC (205)
Downstream   TTTTCTCAAATTCGCTGACG
Igfbp1   
Upstream NM_008341 CCTGCCAACGAGAACTCTAT (196)
Downstream   GGGATTTTCTTTCCACTCCA
Saa3   
Upstream NM_011315.3 GCGAGCCTACTCTGACATGA (196)
Downstream   ATTGGCAAACTGGTCAGCTC
Cldn18   
Upstream NM_019815.2 GCTGTACGAGCCCTGATGAT (193)
Downstream   TGTTGGCAAACACAGACACA
Sfrs1   
Upstream NM_173374.3 CACTGGTGTCGTGGAGTTTG (190)
Downstream   CTTCTGCTACGGCTTCTGCT
Sfrs2   
Upstream NM_013663.3 GCTTTGCTTTCGTCGAATTT (188)
Downstream   AGGACTCCTCCTGCGGTAAT
Eif2   
Upstream NM_026030.2 GGAGTTGCTGAACCGAGTGT (180)
Downstream   AGGAGATGTTTGGGTTGACG
Muc13   
Upstream NM_010739.1 TGCGTGATGCTACAAAGGAC (195)
Downstream   TGTCCTGGCATTTACTGCTG
Igfbp1 (human)   
Upstream NM_000596.2 AAGGCACAGGAGACATCAGG (195)
Downstream   TATCTGGCAGTTGGGGTCTC
Serpina1 (human)   
Upstream NM_001002235.1 TGCCTGATGAGGGGAAACTA (186)
Downstream   CCCCATTGCTGAAGACCTTA
WT1(362–970)   
Upstream NC_000068 TCCAGCAGCCGGAGCAACCT (608)
Downstream   AGGGCGTGTGGCCATAGCTG
WT1(947–1470)   
Upstream NC_000068 CGCCCAGCTATGGCCACACG (523)
Downstream   ATTGCAGCCTGGGTATGCAC
WT1(1444–1943)   
Upstream NC_000068 TTCATGTGTGCATACCCAGG (499)
Downstream   GTAGATCCACAGTCGTGTCC
  1. *PCR product size