Skip to main content

Table 1 Primers and RT-PCR conditions for expression analysis

From: Involvement of GTA protein NC2β in Neuroblastoma pathogenesis suggests that it physiologically participates in the regulation of cell proliferation

PCR primers RT-PCR conditions
NC2β fw: 5' CGATGATGATCTCACTATCC 3'
NC2β rev: 5' GTTGCTGTCTAGCTTTTGC 3'
50°C 30 min; (94°C 60 sec, 47°C 90 sec, 72°C 2 min) 25×; 72°C 10 min.
NC2α fw: 5' AGACGGACGAAGAGATTGG 3'
NC2α rev: 5' CATGTCGGGAACAGATGC 3'
50°C 30 min; (94°C 60 sec, 53°C 90 sec, 72°C 2 min) 27×; 72°C 10 min.
GTF2B fw: 5' AGAAGAGCCTGAAGGGAAGAGC 3'
GTF2B rev: 5' CAGCAACACCAGCAATATCTCC 3'
50°C 30 min; (94°C 60 sec, 50°C 90 sec, 72°C 2 min) 27×; 72°C 10 min.
TAF12 fw: 5' GAGCAGTTGGATGAAGATGTGG 3'
TAF12 rev: 5' TGAGATGGCAGGGAAAAGG 3'
50°C 30 min; (94°C 60 sec, 57°C 90 sec, 72°C 2 min) 26×; 72°C 10 min.
TAF13 fw: 5' GCAGATGAGGAAGAAGACC 3'
TAF13 rev: 5' TATCTTCAACTTGTACTCGACC 3'
50°C 30 min; (94°C 60 sec, 54°C 90 sec, 72°C 2 min) 27×; 72°C 10 min.
β actin fw: 5' GTGCCCATCTATGAGGGTTACG 3'
β actin rev: 5' TGATCCACATCTGCTGGAAGG 3'
50°C 30 min; (94°C 60 sec, 46°C 90 sec, 72°C 2 min) 25×; 72°C 10 min.