Skip to main content

Table 2 Microsatellite polymorphic markers used for GI analysis

From: Involvement of GTA protein NC2β in Neuroblastoma pathogenesis suggests that it physiologically participates in the regulation of cell proliferation

Locus Marker Chromosomal Position Heterozygosity PCR primers Size (bp) PCR conditions
NC2β 5' D1S2776 92982656 – 92982869 0.75 5' AATGCCTGTCTTTATCCCTG 3'
5' AATGTAAGAGAAATGCCCCT 3'
196 – 212 95°C 10 min (95°C 30 sec, 52°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
NC2β 3' D1S2813 95036107 – 95036299 0.72 5' CTTTTGACTCACTGGAAGACAT 3'
5' CCCCACCGTATCTGGTAT 3'
185 – 205 95°C 10 min (95°C 30 sec, 55°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
NC2β 3' D1S2664 95718483 – 95718723 0.73 5' CAGCCCACAGAATAACACTG 3'
5' TTCATGCTATGATTTTCCGC 3'
202 – 254 95°C 10 min (95°C 30 sec, 54°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
TAF12 5' D1S2787 27999563 – 27999728 0.76 5' TTTAACCCTGGAAGGTTGAG 3'
5' ACAGGACAATGCTGTCAGTATG 3'
137 – 167 95°C 10 min (95°C 30 sec, 52°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
TAF12 3' G60315 30205319 – 30205625 - 5' AGCTGAGTCAGGGAAACCCATT 3'
5' TGTGCTCTTCAATGTGTTAGGGA 3'
307 – 340 95°C 10 min (95°C 30 sec, 56°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
TAF13 5' D1S2778 108849441 – 108849609 0.66 5' CACAGTTAAATTGCATTTCC 3'
5' GCTCACCATAAACAAGAGG 3'
161 – 173 95°C 10 min (95°C 30 sec, 50°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
TAF13 3' D1S221 110103235 – 110103467 0.75 5' CCTACAACTCCATCCTGTCC 3'
5' GTCTTAAGTCGCTCTGCCTG 3'
215 – 225 95°C 10 min (95°C 30 sec, 56°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
NC2α 3' D11S1889 67069719 – 67069901 0.67 5' AGCTGGACTCTCACAGAATG 3'
5'CAAGAGGCTGGTAGAAGGTG3'
183 – 207 95°C 10 min (95°C 30 sec, 60°C 30 sec, 72°C 30 sec) 30×; 72°C 10 min
NC2α 3' D11S4178 67945684 – 67945935 0.69 5' CAGGCCCAGTCTCTTG 3'
5' CGTGTCCAGATGAAAGTG 3'
237 – 260 95°C 10 min (95°C 30 sec, 52°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min.
GTF2B 5' D1S2856 82130207 – 82130465 0.5 5' AGCTCTGTGACATTGGATAA 3'
5' CAGAACATAATAAGTGTGGCTA 3'
257 – 263 95°C 10 min (95°C 30 sec, 53°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min.
GTF2B 5' D1S454 82540746 – 82540872 0.56 5' TGTTAGTTCCTGTTCTTGGTGA 3'
5' TTCCCTGGAAACAACCATAA 3'
155 – 163 95°C 10 min (95°C 30 sec, 58°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min
GTF2B 3' D1S435 91331437 – 91331556 0.73 5' GGCCACATGGGAATTTTCT 3'
5' AGCAGTTCAAGGCCACAGT 3'
157 – 177 95°C 10 min (95°C 30 sec, 55°C 75 sec, 72°C 30 sec) 30×; 72°C 10 min