Skip to main content

Table 3 The primer sequences and annealing temperatures for qRT-PCR

From: Similarity of aberrant DNA methylation in Barrett's esophagus and esophageal adenocarcinoma

Gene Forward primer Reverse primer Annealing temperature (°C)
APC TGGAGAACTCAAATCTTCGACA CAATCTGTCCAGAAGAAGCCATA 62
CDKN2A GAGGCCGATCCAGGTCAT CCAGCGTGTCCAGGAAG 62
HMBS ACATGCCCTGGAGAAGAATG TTGGGTGAAAGACAACAGCA 57
ID4 CCGAGCCAGGAGCACTAGAG CTTGGAATGACGAATGAAAACG 60
MGMT TGGAGCTGTCTGGTTGTGAG GCTGGTGGAAATAGGCATTC 60
RBP1 AGGCATAGATGACCGCAAG CTCATCACCCTCGATCCAC 62
RUNX3 GCAGGCAATGACGAGAACTA CAGTGATGGTCAGGGTGAAA 57
SFRP1 TTGAGGAGAGCACCCTAGGC TGTGTATCTGCTGGCAACAGG 60
TIMP3 CCAGGACGCCTTCTGCAAC CCTCCTTTACCAGCTTCTTCCC 60
TMEFF2 CAATGGGGAGAGCTACCAGA TGGACTCCATCTCCAGATCC 62