Skip to main content

Table 1 Sequences (5'- 3') of primers and probes used in quantitative real time RT-PCR analysis of mouse (m) and human (h) gene expression.

From: Paracrine sonic hedgehog signalling by prostate cancer cells induces osteoblast differentiation

Gene Forward Primer Probe Reverse Primer
mGli1 GGAAGTCCTATTCACGCCTTGA TCAAGACGCACCTTCGGTCGCAC CAACCTTCTTGCTCACACATGTAAG
mPtc1 CTCCAAGTGTCGTCCGGTTT CGTGCCTCCTGGTCACACGAACAA ACACCGTGGTCTGAGAGCTGTAC
mAkp2 TCAGGGCAATGAGGTCACATC CGCTGGGCCAAGGATGCTGG CACCCGAGTGGTAGTCACAATG
mRunx2 CGAAATGCCTCCGCTGTTAT TAGCCAGGTTCAACGAT CGCTCCGGCCCACAA
mOcn GGCCCTGAGTCTGACAAAGC TTCATGTCCAAGCAGGAGGGCA GCCGGAGTCTGTTCACTACCTT
mOpn CATGAAGAGCGGTGAGTCTAAGG TCCCTCGATGTCATCCCTGTTGCC CTTTCCGTTGTTGTCCTGATCA
mGapdh AACCTGCCAAGTATGATGACATCA TGAAGCAGGCATCTGAGGGCCC CTGTTGAAGTCGCAGGAGACAA
hSHH AAGGACAAGTTGAACGCTTTGG ATCTCGGTGATGAACCAGTGGCCAG TCGGTCACCCGCAGTTTC
hGLI1 GGGCACCATCCATTTCTACAGT AGCCCAAGAGGGAGCGGGAAGG TCAGTCTGCTTTCCTCCCTGAT
hGAPDH CGACAGTCAGCC GCATCTT CGCCAGCCGAGCCACATCG TGACCAGGCGCCCAATAC