Skip to main content

Table 1 Oligonucleotide primers used in RT-PCR

From: Epstein-Barr virus-encoded EBNA1 inhibits the canonical NF-κB pathway in carcinoma cells by inhibiting IKK phosphorylation

Gene RT-PCR primer oligonucleotides (5'-3')
TNFR1 Forward: GCTCCTTCACCGCTTCAGA
Reverse: CCAATGAAGAGGAGGGATAAA
TNFR2 Forward: CAGCCTTGGGTCTACTAATA
Reverse: GCCACCAGGGGAAGAATC
IL1R1 Forward: GTGATGAATGTGGCTGAAA
Reverse: CTGGGTCATCTTCATCAAT
IL1R2 Forward: CAGAGTTTTTGAGAATACAGAT
Reverse: GTCCCCCTCACACTTAGAA
C/EBPβ (NF-IL6) Forward: GACTTCCTCTCCGACCTCT
Reverse: TGCTTGTCCACGGTCTTCTT
IL1α Forward: GAAGAAGAGACGGTTGAGTTT
Reverse: GCACTGGTTGGTCTTCATCT
A20 Forward: CCCAGACCACACAAGGCA
Reverse: GGCAGTATCCTTCAAACAT
EBNA1 Forward: CCGCAGATGACCCAGGAGAA
Reverse: TGGAAACCAGGGAGGCAAAT
GAPDH Forward: GCCTCCTGCACCACCAACTG
Reverse: CGACGCCTGCTTCACCACCTTCT