Skip to main content

Table 7 Primer sequences for real time PCR.

From: Gene expression profiling of cholangiocarcinoma-derived fibroblast reveals alterations related to tumor progression and indicates periostin as a poor prognostic marker

Gene Forward Primer Reverse Primer Size Accession no.
  5'-3' 5'-3' (bp)  
ADAM12 tttgggggtcaacagttttc agagctgggttcccttttgt 191 NM_003474
AREG tggggaaaagtccatgaaaa tttcgttcctcagcttctcc 174 NM_001657
AGN2 ccacctgaggaactgtctcg ggtcttgctttggtccgtta 191 NM_001147
ER catatgggagaagggggagt aagtgcaattacagagtgcaaaa 166 NM_001432
JAGL1 gcctgccttaagtgaggaaa gccaagaacaacacatcaaaga 169 U77914
LAMA5 gtgatgaaaagcgggaatgt acctccacagagcgagtcat 221 BC003355
NOV tgcaattccaagaaaatatcactg cttggatttggagcttggaa 167 NM_002514
PDGF-A acacgagcagtgtcaagtgc tctggttggctgctttaggt 250 X03795
PN cactctttgctcccaccaat tcaaagactgctcctcccata 157 AY140646
RL tgctgaatttggggctactt gggagatagggtcttcatcca 198 NM_005045
SCG2 cccgaagaatgatgataccc aaatgttgggatttgcttgg 195 NM_003469
ITGα 5 agttgcatttccgagtctgg ccaaacaggatggctaggat 223 NM_002205
β-actin cacactgtgcccatctacga ctccttaatgtcacgcacga 162 X00351
gapdh ctcctcctgttcgacagtca gttaaaagcagccctggtga 140 NM_002046
  1. Note: ADAM12, a disintegrin and matrix metalloproteinase 12; AREG, amphiregulin; AGN2, angiopoietin 2; ER, epiregulin; JAGL1, jagged soluble form; LAMA5, laminin alpha 5; NOV, nephroblastoma over expressed; PDGF-A, platelet-derived growth factor alpha; PN, periostin; RL, reelin; SCG2, secretogranin 2; ITGα5, integrin alpha 5; β-actin, beta-actin; gapdh, glyceraldehyde 3-phosphate dehydrogenase