Table 1 Primer Sets for Amplification of EGFR Isoforms and Mutants.
From: EGFR isoforms and gene regulation in human endometrial cancer cells
Primer set name | Sequence | Expected band size (bp) |
|---|---|---|
EGFR forward extracellular 1 (Xcell 1) | ccagtattgatcgggagagc | 1873 |
EGFR reverse extracellular 1 (Xcell 1) | acaacaccctggtctggaag | Â |
EGFR forward extracellular 2 (Xcell 2) | agcctccagaggatgttcaa | 1318 |
EGFR reverse extracellular 2 (Xcell 2) | tggttttctgaccggaggt | Â |
EGFR forward extracellular 3 (Xcell 3) | caaaaactgcacctccatca | 854 |
EGFR reverse extracellular 3 (Xcell 3) | ggatcttaggccccattcgtt | Â |
EGFR forward intracellular (Intracell) | cctaagatcccgtccatcg | 1769 |
EGFR reverse intracellular (Intracell) | ttggtcctgggtatcgaaag | Â |
EGFR isoform B forward | aacaacaccctggtctggaa | 160 |
EGFR isoform B reverse | tgaagcaaagggagaaattga | Â |
EGFR isoform C forward | ggatattctgaaaaccgtaaaggaaa | 96 |
EGFR isoform C reverse | cgaaaagttctctctaaaacactgatt | Â |
EGFR isoform D forward | ccagtgtgcccactacattg | 221 |
EGFR isoform D reverse | cgctgccatcattactttga | Â |
Sequencing primers (exon 18-22) forward | ccaaccaagctctcttgagg | 540 |
Sequencing primers (exon 18-22) reverse | tgataggcactttgcctcct | Â |