Skip to main content

Table 2 PCR primer pairs used in the present study

From: Serum N-glycome biomarker for monitoring development of DENA-induced hepatocellular carcinoma in rat

Rattus Norvegicus Gene Forward Primer (5'-3') Reverse Primer (5'-3') Amplicon Length (bp)
FUT8 CCATCCTCGGCCTCCTTACT ACTGGGACACCCACCACACT 101
GAPDH ACTCTACCCACGGCAAGTTC TACTCAGCACCAGCATCA 133
Ywhaz AAAAAGGAGATGCAGCCGAC GTTGAGGGCCAGACCCAGT 51