Figure 1

PRAME expression in leukaemia and lymphoma cell lines. A: Northern blot analysis of PRAME expression in leukaemia and lymphoma cell lines. Samples contained 50 μg of total RNA extracted from tumour cell lines. After Northern blotting, membranes were hybridised with a ³²P-labelled probe consisting of full-length PRAME coding region, washed at high stringency and visualised using a phosphorimager. A control probe (β-actin) was used to confirm equal loading. Both overnight and extended exposures are shown. B: Semi-quantitative RT-PCR analysis of PRAME and GAPDH expression in leukaemia and lymphoma cell lines. RNA was extracted and reversed transcribed using oligo(dT)_12-18. cDNA was amplified using primers: PRAME forward (5'atggaacgaaggcgtttg-3'), PRAME reverse (5'-ctagttaggcatgaaacaggg-3'), GAPDH forward (5'-aggtgaaggtcggagtcaac-3') and GAPDH reverse (5'-gatgacaagcttcccgttct-3'). An aliquot of the PCR reaction was removed after 36, 38 and 40 cycles for the PRAME reaction as indicated, or 35 cycles for the GAPDH control. PCR products were visualised by gel electrophoresis. C: Induced expression of PRAME in U937 after DNA demethylation. Leukaemia cell lines U937 (low levels of PRAME) and K562 (PRAME overexpressed) were cultured in RPMI plus 10% foetal bovine serum and treated with 1 μM 5-aza-2'-deoxycytidine for 0-72 hours. RNA was extracted and reverse transcribed for expression analysis. PRAME mRNA levels were quantified by real-time qPCR using the following primers: PRAME 254F (tgctgatgaagggacaacat), PRAME 364R (cagcacttgaagtttccacct). GAPDH primers were as in Fig. 1B. Fold increase in PRAME expression was calculated by the standard delta-delta CT method, relative to GAPDH.