Skip to main content

Table 2 Primers and probes for miR-199a-5p, DDR1 and reference genes.

From: Role of microRNA-199a-5p and discoidin domain receptor 1 in human hepatocellular carcinoma invasion

Gene Primer Sequence (5'→3')
miR-199a-5p RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAACAGGT
  Forward ACACTCCAGCTGGGCCCAGTGTTCAGACTAC
  Reverse CTCAACTGGTGTCGTGGAGTCGGCAA
  Probe (6-FAM) TTCAGTTGAGGAACAGGT (MGB*)
RNU44 Forward CCTGGATGATGATAGCAAATGC
  Reverse GGCAATTCAGTTGAGAGTCAGTTAGA
  Probe (6-FAM) ACTGAACATGAAGGTCTT (MGB*)
HMBS
(TaqMan assay)
Forward ATGTCTGGTAACGGCAATGC
  Reverse GTACCCACGCGAATCACTCT
  Probe (6-FAM) CTGCAACGGCGGAAGAAAACAGC
DDR1 Forward AATCGCAGACTTTGGCATGAG
  Reverse CGTGAACTTCCCCATGAGGAT
GAPDH Forward TGCACCACCAACTGCTTAGC
  Reverse GGCATGGACTGTGGTCATGAG
HMBS
(SYBR Green assay)
Forward TGCAACGGCGGAAGAAAA
  Reverse ACGAGGCTTTCAATGTTGCC
HPRT1 Forward TGACACTGGCAAAACAATGCA
  Reverse GGTCCTTTTCACCAGCAAGCT
SDHA Forward TGGGAACAAGAGGGCATCTG
  Reverse CCACCACTGCATCAAATTCATG
  1. *MGB: minor grove binder with non fluorescent quencher; miR-199a-5p: microRNA excised from the 5' arm of microRNA-199a precursor; RNU44: small nucleolar RNA, C/D box 44; HMBS: hydroxymethyl-bilane synthase; DDR1: discoidin domain receptor-1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; HPRT1: hypoxanthine phosphoribosyl-transferase 1; SDHA: succinate dehydrogenase complex, subunit A.