Skip to main content

Table 4 DDR1 mRNA is predicted to be a potential target of miR-199a-5p by TargetScanS

From: Role of microRNA-199a-5p and discoidin domain receptor 1 in human hepatocellular carcinoma invasion

  predicted consequential pairing of target region (top)
and miRNA (bottom)
Position 1165-1185 of DDR1 3' UTR 5' ...AGAAAUAUAGGAUAGACACUGGA...
                                         | | | | | | |
hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC
Position 1199-1219 of DDR1 3' UTR 5' ...GGAGCACCUGGGCCCCACUGGAC...
                                           | | | | | |
hsa-miR-199a-5p 3'  CUUGUCCAUCAGACUUGUGACCC
Position 1260-1280 of DDR1 3' UTR 5' ...CUCUCUCCCUGUCACACACUGGA...
                                          | | | | | | |
hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC
Position 1383-1403 of DDR1 3' UTR 5' ...CCUCCAUCACCUGAAACACUGGA...
                                          | | | | | | |
hsa-miR-199a-5p 3'    CUUGUCCAUCAGACUUGUGACCC