Skip to main content

Advertisement

Table 1 PCR primers used in ChIP and HaloCHIP experiments.

From: Epstein-Barr virus-encoded EBNA1 enhances RNA polymerase III-dependent EBER expression through induction of EBER-associated cellular transcription factors

Gene (promoter region) Primer oligonucleotides (5'-3')
TFIIIC220* Forward: GTTTGCAGTTCCCCTGGTTAC Reverse: CTTCGTCCAACAACGACTCC
TFIIIC110* Forward: TCTCCCCTTTTTGACACTGC Reverse: AGGGGGAGGAGTAATTGTGG
TFIIIC102 Forward: CGGTTCCTTGCTCTTGCT Reverse: GCATCGCCTCACTTTCTT
TFIIIC90 Forward: GCGGGTAGGGACAAGACT Reverse: CCCAGACAGGCTTTAGTT
TFIIIC63 Forward: GCCAACACCGACAGAATA Reverse: CGGAGGATAATAAGACACAAA
5S RNA Forward: TTTACGGCCACACCACCCTG Reverse: AAAGCCTTCAGCACCCTGTA
tRNAtyr Forward: CCTTCGATAGCTCAGCTGGTAGAGCGGAGG Reverse: CGGAATTGAACCAGCGACCTAAGGATGTCC
7SL RNA (gene) Forward: GTGTCCGCACTAAGTTCGGCATCAATATGG Reverse: TATTCACAGGCGCGATCCCACTACTGATC
7SL RNA (upstream promoter) Forward: CCGTGGCCTCCTCTACTTG Reverse: TTTACCTCGTTGCACTGCTG
Brf1 Forward: GCAAGGAGGTCAGGCACT Reverse: CCTTCCACGGCTACCTCT
Bdp1 Forward: GTTTCTTCACACCAGCATT Reverse: GCTACTGAGACTGGGTTA
TBP Forward: CGCCCCTCCTTACCTAT Reverse: CAATCTGTTACCTGGGTC
ATF-2 Forward: CCCAAACCTCACCTAACCCGAAG Reverse: CTCGGGCGCTCATGATTGGACAA
c-myc Forward: TCCTCTCTCGCTAATCTCCGC Reverse: CCCTCCGTTCTTTTTCCCG
c-jun Forward: CCCACAAGTGGGGAAACAACAA Reverse: GCTACCAGTCAACCCCTAAAAATA
GAPDH Forward: TACTAGCGGTTTTACGGGCG Reverse: TCGAACAGGAGGAGCAGAGAGCGA
EBV-DS Forward: CCGTGACAGCTCATGGGGTGGGAGAT Reverse: CAATCAGAGGGGCCTGTGTAGCTACCG
EBERs Forward: CCGCCTACACACCAACTAT Reverse: GGGATTAGAGAATCCTGACTT
  1. * Primer sets previously described [29]. Primer set previously described [62].