Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 PCR primers used in ChIP and HaloCHIP experiments.

From: Epstein-Barr virus-encoded EBNA1 enhances RNA polymerase III-dependent EBER expression through induction of EBER-associated cellular transcription factors

Gene (promoter region) Primer oligonucleotides (5'-3')
TFIIIC220* Forward: GTTTGCAGTTCCCCTGGTTAC
Reverse: CTTCGTCCAACAACGACTCC
TFIIIC110* Forward: TCTCCCCTTTTTGACACTGC
Reverse: AGGGGGAGGAGTAATTGTGG
TFIIIC102 Forward: CGGTTCCTTGCTCTTGCT
Reverse: GCATCGCCTCACTTTCTT
TFIIIC90 Forward: GCGGGTAGGGACAAGACT
Reverse: CCCAGACAGGCTTTAGTT
TFIIIC63 Forward: GCCAACACCGACAGAATA
Reverse: CGGAGGATAATAAGACACAAA
5S RNA Forward: TTTACGGCCACACCACCCTG
Reverse: AAAGCCTTCAGCACCCTGTA
tRNAtyr Forward: CCTTCGATAGCTCAGCTGGTAGAGCGGAGG
Reverse: CGGAATTGAACCAGCGACCTAAGGATGTCC
7SL RNA
(gene)
Forward: GTGTCCGCACTAAGTTCGGCATCAATATGG
Reverse: TATTCACAGGCGCGATCCCACTACTGATC
7SL RNA
(upstream promoter)
Forward: CCGTGGCCTCCTCTACTTG
Reverse: TTTACCTCGTTGCACTGCTG
Brf1 Forward: GCAAGGAGGTCAGGCACT
Reverse: CCTTCCACGGCTACCTCT
Bdp1 Forward: GTTTCTTCACACCAGCATT
Reverse: GCTACTGAGACTGGGTTA
TBP Forward: CGCCCCTCCTTACCTAT
Reverse: CAATCTGTTACCTGGGTC
ATF-2 Forward: CCCAAACCTCACCTAACCCGAAG
Reverse: CTCGGGCGCTCATGATTGGACAA
c-myc Forward: TCCTCTCTCGCTAATCTCCGC
Reverse: CCCTCCGTTCTTTTTCCCG
c-jun Forward: CCCACAAGTGGGGAAACAACAA
Reverse: GCTACCAGTCAACCCCTAAAAATA
GAPDH Forward: TACTAGCGGTTTTACGGGCG
Reverse: TCGAACAGGAGGAGCAGAGAGCGA
EBV-DS Forward: CCGTGACAGCTCATGGGGTGGGAGAT
Reverse: CAATCAGAGGGGCCTGTGTAGCTACCG
EBERs Forward: CCGCCTACACACCAACTAT
Reverse: GGGATTAGAGAATCCTGACTT
  1. * Primer sets previously described [29]. Primer set previously described [62].