Skip to main content

Advertisement

Table 2 RT-PCR primers.

From: Epstein-Barr virus-encoded EBNA1 enhances RNA polymerase III-dependent EBER expression through induction of EBER-associated cellular transcription factors

Gene Primer oligonucleotides (5'-3')
ATF-2 Forward: CACACAACTCCACAGACCCAAA
Reverse: GGAGCCATAACGATCTGTGAAA
c-Myc Forward: AACCAGAGTTTCATCTGCGACCCG
Reverse: TTGTGCTGATGTGTGGAGACGTGG
5S RNA* Forward: TTTACGGCCACACCACCCTG
Reverse: AAAGCCTTCAGCACCCTGTA
tRNAtyr* Forward: CCTTCGATAGCTCAGCTGGTAGAGCGGAGG
Reverse: CGGAATTGAACCAGCGACCTAAGGATGTCC
7SL RNA * Forward: GTGTCCGCACTAAGTTCGGCATCAATATGG
Reverse: TATTCACAGGCGCGATCCCACTACTGATC
TFIIIC 220* Forward: TCCAGCGAGACCGTCACACC
Reverse: GGATTGAGTGTTGCTGGGCT
TFIIIC 110* Forward: CCAGAAGGGGTCTCAAAGTCC
Reverse: CTTTCTTCAGAGATGTCAAAGG
TFIIIC 102* Forward: GCAGAAGTAACATCATTGGC
Reverse: CCTACTAATGTCCGTTATCTGTGG
TFIIIC 90* Forward: AAACAGAAGTTGCTGAGTGC
Reverse: ATGGTCAGGCGATTGTCC
TFIIIC 63* Forward: ATGGCTTGAAGTCCTCCTCCTCC
Reverse: CCGAGATGTTCTACCAGTTATGCG
Bdp1* Forward: GCTGATAGAGATACTCCTC
Reverse: CCAGAGACAAGAATCTTCTC
Brf1* Forward: AAATTCTGTGAGCCTCTTCCGTAGTG
Reverse: AGACCCATGCTTGTACATTCCACG
TBP* Forward: GCCAGAGTTATTTCCTGGTTT
Reverse: CCCAGATAGCAGCACGGTAT
GAPDH Forward: GCCTCCTGCACCACCAACTG
Reverse: CGACGCCTGCTTCACCACCTTCT
EBER1 Forward: AGGACCTACGCTGCCCTAGA
Reverse: AAAACATGCGGACCACCAGC
EBER2 Forward: GCCGTTGCCCTAGTGGTTT
Reverse: GGGATTAGAGAATCCTGACTT
EBNA1 Forward: CCGCAGATGACCCAGGAGAA
Reverse: TGGAAACCAGGGAGGCAAAT
  1. * Primer sets previously described [29].