Skip to main content

Table 1 Primer Sequences

From: Axin downregulates TCF-4 transcription via β-catenin, but not p53, and inhibits the proliferation and invasion of lung cancer cells

name primer sequence product length temperature cycles
Axin* Forward:5'-ACCGAAAGTACATTCTTGATAAC-3' 452 52 30
  Reverse:5'-TCCATACCTGAACTCTCTGC-3'    
Axin** Forward:5'-TCCACCACCATGTTCACC-3' 243 bp 57.6°C 30
  Reverse:5'-CAGCATTGGCATTCTTCC-3'    
β-catenin Forward:5'-GCCAAGTGGGTGGTATAGAG-3' 330 bp 49°C 30
  Reverse:5'-GCTGGGTATCCTGATGTGC-3'    
p53 Forward:5'-TCAGTCTACCTCCCGCCATA-3' 322 bp 58°C 30
  Reverse:5' TTACATCTCCCAAACATCCCT 3'    
TCF-4 Forward:5'-CGAGGGTGATGAGAACCTGC-3' 444 bp 52°C 30
  Reverse:5'-CCCATGTGATTCGATGCGT-3'    
β-actin Forward:5'-AGAGCTACGAGCTGCCTGAC3' 308 bp 55°C 30
  Reverse:5'-AGTACTTGCGCTCAGGAGGA-3'    
  1. * This primer specifically detects endogenous human Axin mRNA.
  2. **This primer specifically detects exogenous mouse Axin mRNA, but not endogenous human Axin mRNA.