Skip to main content

Table 1 Primer sequences used in rtRT-PCR

From: IGFBP-rP1, a potential molecule associated with colon cancer differentiation

Gene Primer Product
(bp)
Design
AREG 5' CGGGAGCCGACTATGACTACTC 3'
5' GGGCTTAACTACCTGTTCAACTCTG 3'
100 [29]
IRS1 5'CAGAGGACCGTCAGTAGCTCAA 3'
5'GGAAGATATGAGGTCCTAGTTGTGAAT3'
135 [29]
CDKN2B 5'CACCGTTGGCCGTAAACTTAAC 3'
5'TAATGAAGCTGAGCCCAGGTCT 3'
96 [30]
ID1 5' ATTTCTTCTCGTTTTCACAGGC 3'
5' TCGGTCTTGTTCTCCCTCAG 3'
174 [31]
SOX-9 5'AGGTGCTCAAAGGCTACGACT 3'
5'AGATGTGCGTCTGCTCCGTG3'
359 [32]
STC1 5' AACCCTGAAGCCATCACTG 3'
5' GCTTCGGACAAGTCTGTTATAG 3'
78 [33]
TACSTD1 5'TGTTTGGTGATGAAGGCAGA 3'
5' ACGCGTTGTGATCTCCTTCT 3'
324 Primer 5.0
TAGLN 5'ATCCTGTCTGTCCGAACCC 3'
5' GCACTATGATCCACTCCACC 3'
184 Primer 5.0
FRMD4A 5' TGGCTTCTCACTTCAATCT 3'
5' CCACGGGTCCTGACTTTT 3'
134 Primer 5.0
IER5L 5' AGCCCTTGGAGCCTCTGCA 3'
5' CGGAGCCAAAGATGGAGATCA 3'
214 Primer 5.0
SP140 5' TGATCCTCCAAGAATACG 3'
5' ACAAGTGTCGCAACAGAA 3'
141 Primer 5.0
SYN1 5'GTGTCAGGGAACTGGAAGACC 3'
5'TGAGCGGCATGGAGGAAC3'
192 Primer 5.0
LAMB1 5' GAAGACGGGAAGAAAGGG 3'
5' GTCGAGGTCACCGAAAGC 3'
245 Primer 5.0
KERATIN 7 5' CAATGAGACGGAGTTGACAG 3'
5' ACGCTGGTTCTTGATGTT 3'
304 Primer 5.0
KERATIN 8 5' TTGCAGATGCCGAGCAGCGT 3'
5' TGGGCTGAGGGCTAGGGCTG 3'
576 Primer 5.0
PROFILIN2 5' ATTGTCGGCTACTGCG 3'
5' ATTGTATGTTGGCTCC 3'
237 Primer 5.0
GAPDH 5' ACGGATTTGGTCGTATTGGG 3'
5' CGCTCCTGGAAGATGGTGAT 3
213 Primer 5.0