Figure 4From: Epithelial Protein Lost in Neoplasm α (Eplin-α) is transcriptionally regulated by G-actin and MAL/MRTF coactivatorsRecruitment of MAL and SRF to the Eplin-α promoter. Chromatin immunoprecipitation was performed using starved (un.) and stimulated NIH 3T3 cells (CD, 2 μM; FCS, 15%; 30 min), as indicated. Following chromatin preparation, antibodies specific for SRF (G-20, Santa Cruz) and MAL (homemade rabbit serum #79), or a negative control antibody (ctrl), were used for IP as described [19]. The primers used for amplifying an Eplin-α promoter fragment around the putative CarG box were: → (-178AAAAAGTCTCTCCCTTCCAATGT), ← (-15GTTACTGCCCTGCCACAAG). (A) Cytochalasin treatment induces recruitment of MAL to the Eplin-α and srf gene. Immunoprecipitated and input Eplin-α, srf and gapdh promoter fragments were amplified by conventional PCR and visualised by agarose gel electrophoresis. (B) Real-time PCR was performed from three independent chromatin preparations and IPs. Shown is the relative quantitation of gapdh, srf and Eplin-α promoter fragments in SRF and MAL immunoprecipitates, expressed in % of the input chromatin. Error bars, SEM (n = 3). (C) Quantitation of MAL and SRF recruitment to the Eplin-α, srf and gapdh gene following serum stimulation. Bound Eplin-α in MAL immunoprecipitates was increased 5.8 fold by FCS.Back to article page