Skip to main content

Table 1 Primers used to amplify the 3′UTR of the marked gene form genomic DNA

From: MiR-377 targets E2F3 and alters the NF-kB signaling pathway through MAP3K7 in malignant melanoma

MAP3K7 F - CCGCTCGAGCTCTGGGACCGTTACATTTTGA
R- TTTTCCTTTTGCGGCCGCTCCAAGAATCACTGCAGGAAGA
E2F3 F - CCGCTCGAG CCCTGCTGCAAGAGGACTATC
R - TTTTCCTTTTGCGGCCGCTGTGCCTACCATTGGGTCAG
KRAS F – CCGCTCGAGTAAGGCATACTAGTACAAGTGGTAA
R - TTTTCCTTTTGCGGCCGCGAACCTAAGTCACCTTCTTCCT
CDK6 F - CCGCTCGAG TTTCCTCCTGAGTGGCAAGC
R – TTTTCCTTTTGCGGCCGCTGGAGAGAAAACAGCAGCCT
  1. Italics letters mark the bases added to the sequences to generate sites for XhoI or NotI or PmeI.