Skip to main content

Table 1 The sequence of the oligonucleotide primers used to amplify specific regions of the promoter

From: Invasion of ovarian cancer cells is induced byPITX2-mediated activation of TGF-β and Activin-A

Gene Name & Acc no Region amplified Forward primer (5′- 3′) Reverse primer (5′- 3′) Amplicon size (kb) Tm (°C)
INHBA; NC_000007.14 41702063 - 41700378 GGACGCGTGAACGCTTTAACAGATGGAC GGAAGCTTGCAAAAGTTGTTGTGATTGC 1.7 54