Table 3 The sequence, respective amplicon size and Tm of the oligonucleotide primers used in ChIP-PCR
From: Invasion of ovarian cancer cells is induced byPITX2-mediated activation of TGF-β and Activin-A
Gene Name & Acc no | Region amplified | Forward primer (5′- 3′) | Reverse primer (5′- 3′) | Amplicon size (kb) | Tm (°C) |
|---|---|---|---|---|---|
INHBA; NC_000007.14 | 41702097- 41701831 | GGCTTATGTGTGGGAAAGAA | ACCAGTGCATTCATAGACAG | 265 | 55.5 |