Skip to main content

Table 3 The sequence, respective amplicon size and Tm of the oligonucleotide primers used in ChIP-PCR

From: Invasion of ovarian cancer cells is induced byPITX2-mediated activation of TGF-β and Activin-A

Gene Name & Acc no Region amplified Forward primer (5′- 3′) Reverse primer (5′- 3′) Amplicon size (kb) Tm (°C)
INHBA; NC_000007.14 41702097- 41701831 GGCTTATGTGTGGGAAAGAA ACCAGTGCATTCATAGACAG 265 55.5