Skip to main content

Advertisement

Table 1 Primers used for RT-PCR and Real Time PCR on PDACs and HPDE

From: The P2X7 receptor regulates cell survival, migration and invasion of pancreatic ductal adenocarcinoma cells

Primers Accession numbers Sequence Product length
P2X7 FW [GenBank: GQ180122.1] CGGTTGTGTCCCGAGTATCC 284 bp
P2X7 RW CCTGGCAGGATGTTTCTCGT  
β actin FW [GenBank: BC014861.1] GTGACATTAAGGAGAAGCTGTGC 300 bp
β actin RW CAATGCCAGGGTACATGGTG  
GUSB FW [GenBank: M15182.1] ACTGACACCTCCAAGTATCCCA 200 bp
GUSB RW AACAGGTTACTGCCCTTGACAG  
QARS FW [GenBank: BC000394.2] CCTCTATGAGCGACTATTCCAGC 200 bp
QARS RW GATGGCTGTCTGGATCCACG