Skip to main content

Table 3 MicroRNA/CpG island probe distribution derived from the Infinium HumanMethylation450 BeadChip

From: MiR-193b promoter methylation accurately detects prostate cancer in urine sediments and miR-34b/c or miR-129-2 promoter methylation define subsets of clinically aggressive tumors

miR TargetID Probe Sequence Chr UCSC Refgene Name UCSC Refgene Accession UCSC Refgene Group UCSC CpG Islands Name Relation to UCSC CpG Island
miR-34b/c cg22879515 GTCCTCCCCGGCAGCGCCGCCCGCTGGCCCAGCTACGCGTGTTGTGCGCTGCGAGGCCGG[CG]GGGGTCCCGCTGGGCCCGGGGGTGTCCTCGGGGGCCGCTTGCGCCCAGCCATGGTAGGGC 11 MIR34B; BTG4; MIR34C NR_029839; NM_017589;NR_029840 TSS200; TSS1500; TSS1500 chr11:111383168–111383892 Island
miR-129-2 cg14416371 GAGACACGAGTCCAGGGGCGCGGAGGGGCGGGCAGCGCGCGGAGTGGTGAGACTGAGCCG[CG]ATGGAACGCGCTGGGGAGACCCAGCCTGTTCGGCTCCAGGGTTCGGAGACATCCTGGGCT 11 MIR129-2 NR_029697 TSS200 chr11:43602545–43603215 Island
miR-152 cg05687686 CAGCTTCGGCATATTTGGCGGAGCCGGGAAGGCCCGGAGCGCAAGAAGGCATCGCAGCCT[CG]CAGCAGATCTGAAAGGGTTGTGGGCGGGGGGCTCATTTTCGCCGGATTTCTTTTCCGTGT 2 MIR1258; ZNF385B NR_031659;NM_152520 TSS1500; TSS1500 chr2:180725717–180726465 S_Shore
miR-193b cg09918657 AGTGGCGTTTCTGGTTTCTCTTTGCTTCCAATCCCCACCAAGCGGAGCGTTGGAATGCGC[CG]CTTATGTCCTCTGAGGACACATCCATATTTATAATTTATTTTTAGGAGAAGTTGTGAAAA 16 MIR193B NR_030177 TSS1500 chr16:14395604–14397075 S_Shore
miR-663a cg08304190 GCCTCACGAGCCCCTGGTCCCGCCACCGGGGCCCCGAAGCGACCACAGCCACAAACTCAA[CG]CCAGGGCCACATCGCTCGTGATTCTCGTCCATCCTCCGACCCGGTCCCGCTCCGGGAGAC 20 MIR663 NR_030386 TSS200 chr20:26188638–26190348 Island
miR-1258 cg05850656 ACTGCTCCAGAGCCCGAGTCGGAGTGTATCACAGAACCTGGGCCGGGGGGGACAGCGGGC[CG]AGCCTCCTTCTTCCAGCTGATCCCTGGCCGGGCTGGACCTGCGCTATCAGCGCGCCCCCA 17 MIR152; COPZ2 NR_029687;NM_016429 TSS200; Body chr17:46114573–46115059 Island