Skip to main content

Advertisement

Table 1 The oligonucleotides used in this study

From: MicroRNA-608 inhibits proliferation of bladder cancer via AKT/FOXO3a signaling pathway

Namea Sequence (5′- > 3′)b
miR-608 mimics (Sense) AGGGGUGGUGUUGGGACAGCUCCGU
NC (Sense) ACUACUGAGUGACAGUAGA
miR-608 Inhibitor ACGAGCUGUCCCAACACCACCCCU
Inhibitor NC CAGUACUUUUGUGUAGUACAA
miR-608 F AGGGGTGGTGTTGGGACAGCTCCGT
miR-608 probec ACGGA GCTGT CCCAA CACCA CCCCT
U6 F TGCGGGTGCTCGCTTCGGCAGC
CDK4 F ATGGCTACCTCTCGATATGAGC
CDK4 R CATTGGGGACTCTCACACTCT
CCND1 F GCTGCGAAGTGGAAACCATC
CCND1 R CCTCCTTCTGCACACATTTGAA
FLOT1 F CCCATCTCAGTCACTGGCATT
FLOT1 R CCGCCAACATCTCCTTGTTC
GAPDH F AAGGTGAAGGTCGGAGTCA
GAPDH R GGAAGATGGTGATGGGATTT
FLOT1 UTR Wt-1 F CTGTCCATTGACAGTGAGGTCCCACCCCTCATCTCTCCTTGCCAAATAG
FLOT1 UTR Wt-1 R TCGACTATTTGGCAAGGAGAGATGAGGGGTGGGACCTCACTGTCAATGGACAGAGCT
FLOT1 UTR Mut-1 F CTGTCCATTGACAGTGAGGTCGGTGGGGTCATCTCTCCTTGCCAAATAG
FLOT1 UTR Mut-1 R TCGACTATTTGGCAAGGAGAGATGACCCCACCGACCTCACTGTCAATGGACAGAGCT
FLOT1 UTR Wt-2 F CAGCCTTCTGATGATCCCACTCCACCCCACCTCAACTTATTTAACTTCG
FLOT1 UTR Wt-2 R TCGACGAAGTTAAATAAGTTGAGGTGGGGTGGAGTGGGATCATCAGAAGGCTGAGCT
FLOT1 UTR Mut-2 F CAGCCTTCTGATGATCCCACTGGTGGGGACCTCAACTTATTTAACTTCG
FLOT1 UTR Mut-2 R TCGACGAAGTTAAATAAGTTGAGGTCCCCACCAGTGGGATCATCAGAAGGCTGAGCT
  1. aF: forward primer, R: reverse primer
  2. bRestriction sites are in bold, Mutated sites are underlined
  3. C5′-DIG and 3′ -DIG labeled