Skip to main content

Table 2 Purchased siRNA and mimics/inhibitor

From: Knockdown of long non-coding RNA NEAT1 inhibits glioma cell migration and invasion via modulation of SOX2 targeted by miR-132

Name Sequences
si-NC 5’-CCCACCAGUUUGAGAC UCCACAAAU-3’
si-NEAT1 5’-GGTCTGTGTGGAAGGAGGAAGGCAG-3’
si-SOX2 5’-CUGCAGUACAACUCCAUGAUU-3’
miR-132 mimics 5’- UGUCAGUUUGUCAAAUACCCCA-3’
miR-132 inhibitor 5’- TGGGGTATTTGACAAACTGACA − 3’
  1. ‘si’ is the short name of short-interferon RNA