Skip to main content

Table 1 Evaluation of diagnostic potential for the differentially expressed tsncRNAs

From: Presence and diagnostic value of circulating tsncRNA for ovarian tumor

ID Sequence information Cancer vs. Control Tumor vs. Control
FDR valuea Fold change AUC 95% CI FDR valuea Fold change AUC 95% CI
ts1 GCATGGGTGGTTCAGTGGTAGAATTCTCGCCT 2.6 × 10−3 4.30 0.865 0.784–0.945 0.05 3.86 0.841 0.756–0.926
ts2 GCATTGGTGGTTCAATGGTAGAATTCTC 1.8 × 10−4 0.44 0.915 0.852–0.978 3.4 × 10−3 0.47 0.904 0.841–0.967
ts3 GCATTGGTGGTTCAGTGGTAGAATTCTC 3.4 × 10−5 0.39 0.948 0.904–0.992 3.3 × 10−4 0.42 0.946 0.904–0.989
ts4 TGGTTCAGTGGTAGAATTCTCGCCT 4.5 × 10−3 6.76 0.836 0.758–0.915 0.08 6.53 0.828 0.754–0.902
ts1-ts4 0.951 0.912–0.991 0.950 0.911–0.989
  1. aWilcox test was used for calculating the values of significance
  2. Abbreviates in table: FDR False discovery rate, AUC Area under Curve, CI Confidence interval