Skip to main content

Table 2 RT-PCR primers

From: Hypoxic BMSC-derived exosomal miRNAs promote metastasis of lung cancer cells via STAT3-induced EMT

Gene Forward primer (5′- to 3′) Reverse primer (5′- to 3′)
E-cadherin CAGGTCTCCTCATGGCTTTGC CTTCCGAAAAGAAGGCTGTCC
N-cadherin AGCGCAGTCTTACCGAAGG TCGCTGCTTTCATACTGAACTTT
Vimentin CGTCCACACGCACCTACAG GGGGGATGAGGAATAGAGGCT
Fibronectin ATGTGGACCCCTCCTGATAGT GCCCAGTGATTTCAGCAAAGG
Snail CACACGCTGCCTTGTGTCT GGTCAGCAAAAGCACGGTT
Twist GGACAAGCTGAGCAAGATTCA CGGAGAAGGCGTAGCTGAG
Zeb1 GCTGGCAAGACAACGTGAAAG GCCTCAGGATAAATGACGGC
Slug TGGTCAAGAAACATTTCAACGCC GGTGAGGATCTCTGGTTTTGGTA
β-actin GTGCTATGTTGCTCTAGACTTCG ATGCCACAGGATTCCATACC