Skip to main content

Table 1 The sequences of primers used for quantitative real-time PCR

From: Lung adenocarcinoma-intrinsic GBE1 signaling inhibits anti-tumor immunity

Gene Sense Primer (5′ → 3′) Antisense Primer (5′ → 3′)
β-actin GCACTCTTCCAGCCTTCCTTCC TCACCTTCACCGTTCCAGTTTTT
GBE1 GGAGATCGACCCGTACTTGAA ACATCTGTGGACGCCAAATGA
TMEM173 AGCATTACAACAACCTGCTACG GTTGGGGTCAGCCATACTCAG
CCL5 CAGTCGTCTTTGTCACCCGA TGTAACTGCTGCTGTGTGGT
CXCL10 AACTGTACGCTGTACCTGCAT GCATCGATTTTGCTCCCCTC
PD-L1 GGACAAGCAGTGACCATCAAG CCCAGAATTACCAAGTGAGTCCT
HLA-A TGGAGAGGAGCAGAGATACACC AGAACCAGGCCAGCAATGATG
HLA-B TCATCTCAGTGGGCTACGTG GTGTGTTCCGGTCCCAATAC
HLA-C GGTGGTGCCTTCTGGACAAG CTCTTCCTCCTACACATCATAGCG
IFI27 TGCTCTCACCTCATCAGCAGT CACAACTCCTCCAATCACAACT
IFI6 CAGAAGGCGGTATCGCTTTTC CCTGCATCCTTACCCGCATT
IFNB1 ATGACCAACAAGTGTCTCCTCC GGAATCCAAGCAAGTTGTAGCTC
IRF7 CCCAGCAGGTAGCATTCCC GCAGCAGTTCCTCCGTGTAG
MX1 AGCGGGATCGTGACCAGAT TGACCTTGCCTCTCCACTTATC
OASL CTGATGCAGGAACTGTATAGCAC CACAGCGTCTAGCACCTCTT
STAT1 CGGCTGAATTTCGGCACCT CAGTAACGATGAGAGGACCCT