Skip to main content

Advertisement

Table 1 Primers and oligos used

From: A novel tumor suppressor protein encoded by circular AKT3 RNA inhibits glioblastoma tumorigenicity by competing with active phosphoinositide-dependent Kinase-1

RT-PCR primers
  Forward primer(5‘to 3’) Reverse primer(5‘to 3’) Amplified product(bps)
 QPCR Circ-AKT3(Divergent primers) AAGTGGCACACACTCTAACTG GTTTTCATTAACTGGCATTCTCG 150
 QPCR Linear-AKT3(Convergent primers) GGAGTCATCATGAGCGATGT TAACTGGCATTTTGCCACTG 192
 QPCR-AKT1 CATGAGCGACGTGGCTATTG GCCTCACGTTGGTCCACATC 150
 QPCR-AKT2 AAGAAGGCTGGCTCCACAAG GCATTCTGCTACGGAGAAGT 158
 QPCR-beta-actin ACAGAGCCTCGCCTTTGCCGAT CTTGCACATGCCGGAGCCGTT 109
Plasmid construction primers
 OV-circ-AKT3 TTCGAATTCAGTGCTGAGATTACAGGCGTGAG TTCGAATTCAGTGCTGAGATTACAGGCGTGAG 686
 OV-AKT3-174aa-flag TTCGAATTCATGAAAACAGAACGACCAAAGC AATGGATCCTTACTTGTCATCGTCATCCTT 609
 Rluc-PCR AGGCTAGCGCCACCATGGCTTCCAAGGTGT TTATTACTGCTCGTTCTTCAGCAC 953
 luc-PCR GCCACCATGGCCGATGCTAA CGCTCGAGTTACACGGCGATCTTGCCGCCTT 1667
 Circ-AKT3-IRES-WT ATGGTACCAATGGACAGAAGCTATCCAGGCTGTA CTGGAATTCCCTTCTCTCGAACCAAAATAACT 233
 Circ-AKT3-IRES-Del-1 ATGGTACCAATGGACAGAAGCTATCCAGGCTGTA CTGGAATTCATCTCTTCCTCTCCTATATTATCAA 126
 Circ-AKT3-IRES-Del-2 ATGGTACCTGGATGCCTCTACAACCCATCA CTGGAATTCCCTTCTCTCGAACCAAAATAAC 125
Probes
 Circ-AKT3-FISH-probe Cy3-TTTCATTAACTGGCATTCTCGCCCCCATTAAC   
 Northern-Circ-AKT3-probe TTTCATTAACTGGCATTCTCGCCCCCATTAAC-DIG   
 Northern-U6-probe TCTTCTCTGTATCGTTCCAATTTTAGTATATGTGC-DIG   
siRNA sequences
 Name sense(5'-3') antisense(5'-3')  
 Circ-AKT3-siRNA-1 GGGGCGAGAAUGCCAGUUAAUtt AUUAACUGGCAUUCUCGCCCCtt  
 Circ-AKT3-siRNA-2 GGCGAGAAUGCCAGUUAAUGAtt UCAUUAACUGGCAUUCUCGCCtt  
 Circ-AKT3-siRNA-NC GCGCCCUGAUUGCCUGAAAUAtt UAUUUCAGGCAAUCAGGGCGCtt