Skip to main content

Advertisement

Table 1 Sequences of primers and siRNAs

From: Exosomal miR-21 regulates the TETs/PTENp1/PTEN pathway to promote hepatocellular carcinoma growth

Name sense (5′-3′) antisense (5′-3′)
Primer set for real-time PCR
 GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
 PTEN CTTACAGTTGGGCCCTGTACCATCC TTTGATGCTGCCGGTAAACTCCACT
 PTENp1 GGATCATTACCTCACACCATACC TCTAAGAAACAACTAAGCCAAAGTC
 TET1 TCTGTTGTTGTGCCTCTGGA GCCTTTAAAACTTTGGGCTTC
 TET2 GAGACGCTGAGGAAATACGG TGGTGCCATAAGAGTGGACA
 TET3 CCCACAAGGACCAGCATAAC CCATCTTGTACAGGGGGAGA
MS QPCR primers
 unmethylated PTENp1 TAGTAGTGAGAATATTTGGATATAGGGC AATTTACTACACCGATTAACTCGTC
 methylated PTENp1 GAGAATATTTGGATATAGGGTGG AATTTACTACACCAATTAACTCATC
 ChIP-PCR primers ATTACGAACCTAGAAGATGCTCTC CTCACAGCGGCTCAACATTC
 GlucMS-qPCR primers ACGAACCTAGAAGATGCTCTCCTC AGCCCGGCCTCGCCTCAC
 miR-21 inhibitor UAGCUUAUCAGACUGAUGUUGA AUCGAAUAGUCUGACUACAACU
siRNAs
 PTENp1 ATCAGAGATCATATAGGAATA  
 TET1 CCAGTCTTAATAAGGTTAT  
 TET2 CAAGACCAATGTCAGAA  
 TET3 GATGAAGGTCCATATTA  
 Negative control AACAGTCGCGTTTGCGACTGG