Skip to main content

Table 1 Sequences of oligo probes and primers

From: Characterization of novel LncRNA P14AS as a protector of ANRIL through AUF1 binding in human cells

AssayOligo nameOligo sequence (5′-3′) Temp.
Northern blottingP14AS probeacgctgcggatcccagaggcttaactggcagctggaacgaggtcctccaacaagaatttagacgctaggtccaattatca  
RNA pull-downP14AS probe #1accaacttgggaccgcaacagatttaccata(1–200 nt) 
 P14AS probe #2gtccttttaaagggtctgactcttcctagaa(1–200 nt) 
 P14AS probe #3ggtgcaggatggtatagagagtggcccgtag(201–400 nt) 
 P14AS probe #4ctgggtcacctctccagcttggaactggcta(401–600 nt) 
 P14AS probe #5gcaggagcgatgtgatccgttatcataactg(601–777 nt) 
 P14AS probe #6aacgaggtcctccaacaagaatttagacgct(601–777 nt) 
 Control #1ttaacgcctcgaatcagcaa  
 Control #2gatcttccagataactgccg  
RNA EMSAprobe#1tttcatttgaaaagaaaattttcaaacatggggaaagctgcaatataagaagaaaacaatggagagacatcgtcactgga  
 probe#2aatactacgggccactctctataccatcctgcacccccagatggagaaactgagggaagtcgtggcctttcaacactctt  
P14AS CRISPR/Cas9gRNA #1catgacagtaagccaaccgatgg(HEK293T) 
 gRNA #2gttagtggactcgagacgaaagg(HEK293T) 
 gRNA #3tgttgcggtcccaagttggtggg(HCT116) 
 gRNA #4gttagtggactcgagacgaaagg(HCT116) 
P14AS promotergRNA#5acaattagatgttcaactggggg(HEK293T) 
CRISPR/Cas9gRNA#6cgtatcttatatagcttatgtgg  
qRT-PCR primersP14AS-F1aacggatcacatcgctcctg254 bp58 °C
 P14AS-R1tccccattcgggttacaacg  
 ALU-Fgaggctgaggcaggagaatcg87 bp60 °C
 ALU-Rgtcgcccaggctggagtg  
 GAPDH-Fgagatggtgatgggatttc224 bp62 °C
 GAPDH-Rgaaggtgaaggtcggagt  
 P16-Fgctgcccaacgcaccgaata180 bp60 °C
 P16-Raccaccagcgtgtccaggaa  
 P15-Fagtcaaccgtttcgggaggcg168 bp62 °C
 P15-Raccaccagcgtgtccaggaag  
(q)RT-PCR primersANRIL-Fcagcagaaggtgggcagcagat145 bp64 °C
 ANRIL-Rttcctcgacagggcaggcaggt  
 18S rRNA-Fgcttaatttgactcaacacggga69 bp58 °C
 18S rRNA-Ragctatcaatctgtcaatcctgtc  
RT-PCR primersP14AS-F2taggatatggtaaatctgttgcggt1043 bp58 °C
 P14AS-R2gagccaggaataaaataaggggaat  
P14AS promoter primersP14AS-F3ccatgtgatttaggaagaaagtttc1281 bp/628 bp58 °C
 P14AS-R3ttaacaacagcattattacctgggc  
PCR Out-primersP14AS-F4taggatatggtaaatctgttgcggt1234 bp58 °C
 P14AS-R4tagggagggaggaaagacaaggaa  
PCR In-primersP14AS-F5caaacatggggaaagctgcaa164 bp58 °C
 P14AS-R5cccttccaagccagatggag  
siRNAP14AS-S1Fggaagagucagacccuuuatt  
 P14AS-S1Ruaaagggucugacucuucctt  
 P14AS-S2Fgcuuacugucauggaaauutt  
 P14AS-S2Raauuuccaugacaguaagctt  
 P14AS-S3Fagccugggcuagagacgaatt  
 P14AS-S3Ruucgucucuagcccaggcutt  
 AUF1-S1Fcguggguucugcuuuauuatt  
 AUF1-S1Ruaauaaagcagaacccacgtt  
 AUF1-S2Fgccaugucgaaggaacaautt  
 AUF1-S2Rauuguuccuucgacauggctt  
 AUF1-S3Fcuacuauggauauggugautt  
 AUF1-S3Raucaccauauccauaguagtt  
 Scramble-Fuucuccgaacgugucacgutt  
 Scramble-Racgugugacacguucggagaatt