Skip to main content

Table 1 List and sequence of primers used in this manuscript for qPCR amplification

From: Inhibition of telomerase activity preferentially targets aldehyde dehydrogenase-positive cancer stem-like cells in lung cancer

Gene Sequence (5'- > 3')
ALDH s TCCTGGTTATGGGCCTACAG
  as CTGGCCCTGGTGGTAGAATA
ABCG2 s CACCTTATTGGCCTCAGGAA
  as CCTGCTTGGAAGGCTCTATG
BMI1 s ATGCAGCTCATCCTTCTGCT
  as GCATCACAGTCATTGCTGCT
DKC s TAATGTTGGCCCCATAGCAG
  as CACATGGTGACAATGCATGA
hTERT s CGTGGTTTCTGTGTGGTGTC
  as CCTTGTCGCCTGAGGAGTAG
MDR1 s GCTCCTGACTATGCCAAAGC
  as TCTTCACCTCCAGGCTCAGT
OCT4 s ACATCAAAGCTCTGCAGAAAGAACT
  as CTGAATACCTTCCCAAATAGAACCC