Skip to main content

Table 3 Primers and probes used for PCR and qRT-PCR

From: SNPs in the coding region of the metastasis-inducing gene MACC1 and clinical outcome in colorectal cancer

Gene Primer/Probe Sequence 5’-3’
MACC1, exon 4 Forward primer atctagtcgagtatcctaccag
  Reverse primer cagaggtagaccttcaacaattat
MACC1, exon 5.1 Forward primer cttgattgtaactcacagtgcc
  Reverse primer gaggttgcctaacatgatttcc
MACC1, exon 5.2 Forward primer gaattccaagaggtgtctctaag
  Reverse primer cttcacctgcttccaactgc
MACC1, exon 5.3 Forward primer ggacacaattatatgccaggac
  Reverse primer gcagtgtacaagtccaatcttac
MACC1, exon 5.4 Forward primer ggacacaattatatgccaggac
  Reverse primer gcagtgtacaagtccaatcttac
MACC1, exon 5.5 Forward primer gcagtgctaagacaaagcaag
  Reverse primer catttctcctctcacatggttcag
MACC1, exon 6 Forward primer ctctggcttagttatgtctactg
  Reverse primer gtgaatccgtgaatgtggtatg
MACC1, exon 7 Forward primer gtccatgtgtaattggtattccg
  Reverse primer tctgagattctttctttcctacac
Met, exon 14 Forward primer gtcgattcttgtgtgctgtctt
  Reverse primer cagaggtaaatacttcctttagg
Met, exon 15 Forward primer gctaccactgcttccattcttaaggac
  Reverse primer ttgcttccatgcacaagggcaaatcc
Met, exon 16 Forward primer gcttatatccttgggtgaaatgtgttgcatc
  Reverse primer atgagggctctgagggatcatttcag
Met, exon 17 Forward primer aaccctcaggacaagatgctaa
  Reverse primer ggtgcatttgaatgatgctaacat
Met, exon 18 Forward primer aggcttgagccattaagaccaa
  Reverse primer ccagggcttacacatcgattta
Met, exon 19 Forward primer gaggccagatgaaatacttcct
  Reverse primer atgaagaaaactggaattggtggt
MACC1, SNP L31V Forward primer gaagctggaaaagtctcaaaaagtt
  Reverse primer aactttttgagacttttccagcttc
MACC1, SNP S515L Forward primer taaaaagactcttgaatctgccagg
  Reverse primer cctggcagattcaagagtcttttta
MACC1, SNP R804T Forward primer gaaataactacacagatgtgttaca
  Reverse primer tgtaacacatctgtgtagttatttc
MACC1, qRT-PCR Forward primer ttcttttgattcctccggtga
  Reverse primer actctgatgggcatgtgctg
  FITC-probe gcagacttcctcaagaaattctggaagatcta-FITC
  LCRed640 LCRed640-agtgtttcagaacttctggacattttagacga