Skip to main content

Advertisement

Table 2 siRNA nucleotides

From: Regulation of PMP22 mRNA by G3BP1 affects cell proliferation in breast cancer cells

siRNA oligonucleotide Sequence
Control 48% GC UUACGGAUCGACUUAAGCCGUUGCA
G3BP1 I GCGCAUUAACAGUGGUGGGAAAUUA
G3BP1 II CCAAGAUGAGGUCUUUGGUGGGUUU
G3BP1 III ACAUUUAGAGGAGCCUGUUGCUGAA
G3BP2 I AACUCAUGAAGAAUUCCUUUAGCUC
G3BP2 II GCUGAAUAAAGCUCCGGAAUAUUUA
G3BP2 III GGAGCCUUUGGAAGAAUCCUCUCAU
PMP22 I GGACACGCAACUGAUCUCUGGCAGA
PMP22 II ACAUCACUGGAAUCUUCCAAAUUCU
PMP22 III CCGGAGUGGCAUCUCAACUCGGAUU